Sploot Sonya Blade Digital Cryptocurrency Dog - Mix of German Shepard, Pitbull terrier, Poodle, Husky, Golder Retriever, Pug, Shiba Inu, Boxer and Border Collie

Achievements

None
Sploot Sonya Blade
Hello there, my name is Sploot Sonya Blade. This dawg chases mice in a big data warehouse. I'm always up for some puppy action, is that wrong? I love unconditionally. I hate it when my human runs out of poop-bags. How embarrassing! If I had to pick a favorite food it would be a hot-dog, because you are what you eat!
  • Purity 3%
  • Age 55 days
  • Racing Exp 0
  • German Shepard 18%
  • 0 races
  • Gen 3
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCAGACACAAGATCCTCATCCGAAGTAAACTAC
T
C
A
G
A
C
A
C
A
A
G
A
T
C
C
T
C
A
T
C
C
G
A
A
G
T
A
A
A
C
T
A
C
Genes: 7I48N7N2EGJ

Composition

German Shepard
18%
Pitbull terrier
18%
Poodle
9%
Husky
9%
Golder Retriever
9%
Pug
9%
Shiba Inu
9%
Boxer
9%
Border Collie
9%

Current Energy

Vitality +9 points
Lunar Effect -6 points

Traits Breakdown

Body German Shepard
Tail Poodle
Legs Husky
Front Legs Golder Retriever
Head Pitbull terrier
Ears German Shepard
Snout Pitbull terrier
Mouth Pug
Nose Shiba Inu
Eyes Boxer
Color Border Collie