Parker Picasso Crypto Game Dog - Mix of Husky, Border Collie, Pug, German Shepard, Pitbull terrier and Boxer

Achievements

None
Parker Picasso
I love unconditionally. I don't like having to stay in the car when my people go inside. I love it when you show a little teeth. The place I like most in the world is curled up in my human's bed, hogging all the covers! Just looking to sow some wild oats here...
  • Purity 19%
  • Age 52 days
  • Racing Exp 0
  • Husky 36%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACAACAACATACTCATCCTACGAAGAAAACACA
A
C
A
A
C
A
A
C
A
T
A
C
T
C
A
T
C
C
T
A
C
G
A
A
G
A
A
A
A
C
A
C
A
Genes: 444J7NJ22G4

Composition

Husky
36%
Border Collie
18%
Pug
18%
German Shepard
9%
Pitbull terrier
9%
Boxer
9%

Current Energy

Vitality +32 points
Lunar Effect 0 points

Traits Breakdown

Body Husky
Tail Husky
Legs Husky
Front Legs Border Collie
Head German Shepard
Ears Pitbull terrier
Snout Border Collie
Mouth Pug
Nose Pug
Eyes Boxer
Color Husky