Pinocchio Pablo Bitcoin Dog - Mix of Corgi, Husky, Labrador, Pitbull terrier, Shiba Inu, Pug and Boxer

Achievements

None
Pinocchio Pablo
I'm Pinocchio Pablo. How goes it? I'm the best at running circle 8's. Small yappy creatures bug me...they disturb my zen. The place I like most in the world is curled up in my human's bed, hogging all the covers! You scratch my belly and I'll scratch yours ;)
  • Purity 7%
  • Age 52 days
  • Racing Exp 0
  • Corgi 27%
  • 0 races
  • Gen 3
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACAAGCACACCATCCGTAAGCCCAGAAAGCAAC
A
C
A
A
G
C
A
C
A
C
C
A
T
C
C
G
T
A
A
G
C
C
C
A
G
A
A
A
G
C
A
A
C
Genes: 4O45NEO52OG

Composition

Corgi
27%
Husky
18%
Labrador
18%
Pitbull terrier
9%
Shiba Inu
9%
Pug
9%
Boxer
9%

Current Energy

Vitality +25 points
Lunar Effect 0 points

Traits Breakdown

Body Husky
Tail Corgi
Legs Husky
Front Legs Labrador
Head Pitbull terrier
Ears Shiba Inu
Snout Corgi
Mouth Labrador
Nose Pug
Eyes Corgi
Color Boxer