Ajax Annie Bitcoin Dog - Mix of Husky, Pitbull terrier, Poodle, Border Collie, Beagle, German Shepard and Rottweiler

Achievements

None
Ajax Annie
I'm 100% digital, baby. I dislike anyone messing with my toys. They are MY toys. But I'd be willing to share with the right partner ;) Squeaky toys are the best, don't you agree? I have a crush on the Grumpy cat. I like to work out by digging fresh holes in landscaped yards.
  • Purity 12%
  • Age 55 days
  • Racing Exp 0
  • Husky 36%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACAGACACAACATCCACATCCTACCTATCACAC
A
C
A
G
A
C
A
C
A
A
C
A
T
C
C
A
C
A
T
C
C
T
A
C
C
T
A
T
C
A
C
A
C
Genes: 4I44N4NJD7H

Composition

Husky
36%
Pitbull terrier
18%
Poodle
9%
Border Collie
9%
Beagle
9%
German Shepard
9%
Rottweiler
9%

Current Energy

Vitality +10 points
Lunar Effect 0 points

Traits Breakdown

Body Husky
Tail Poodle
Legs Husky
Front Legs Husky
Head Pitbull terrier
Ears Husky
Snout Pitbull terrier
Mouth Border Collie
Nose Beagle
Eyes German Shepard
Color Rottweiler