Oakley Ozzie Bitcoin Game Dog - Mix of Husky, Pitbull terrier, Shiba Inu, Border Collie, Beagle, German Shepard and Rottweiler

Achievements

None
Oakley Ozzie
My favorite way to spend playtime is a good game of frisbee. I hate having to wear foo-foo clothes and ribbons in my fur. I've been looking for love in all the wrong places... When I can break free, I enjoy exploring my neighborhood without my human.
  • Purity 12%
  • Age 52 days
  • Racing Exp 0
  • Husky 36%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACAGTAACAACATCCACATCCTACCTATCACAC
A
C
A
G
T
A
A
C
A
A
C
A
T
C
C
A
C
A
T
C
C
T
A
C
C
T
A
T
C
A
C
A
C
Genes: 4E44N4NJD7H

Composition

Husky
36%
Pitbull terrier
18%
Shiba Inu
9%
Border Collie
9%
Beagle
9%
German Shepard
9%
Rottweiler
9%

Current Energy

Vitality +13 points
Lunar Effect 0 points

Traits Breakdown

Body Husky
Tail Shiba Inu
Legs Husky
Front Legs Husky
Head Pitbull terrier
Ears Husky
Snout Pitbull terrier
Mouth Border Collie
Nose Beagle
Eyes German Shepard
Color Rottweiler