Princess Parker Crypto Dog - Mix of German Shepard, Rottweiler, Labrador, Maltese, Husky, Border Collie and Corgi

Achievements

None
Princess Parker
How YOU doin'? Princess Parker here. I run on the information superhighway and haven't been hit by a car yet. I usually spend my days protecting my yard from those pesky squirrels. I don't know what it is, but I know they're up to no good... I'm looking for someone who is also playful, feisty and happy.
  • Purity 8%
  • Age 52 days
  • Racing Exp 0
  • German Shepard 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCACACACACCAACCCACACCCCATACAGCTCA
T
C
A
C
A
C
A
C
A
C
C
A
A
C
C
C
A
C
A
C
C
C
C
A
T
A
C
A
G
C
T
C
A
Genes: 7H45KHK5JO7

Composition

German Shepard
18%
Rottweiler
18%
Labrador
18%
Maltese
18%
Husky
9%
Border Collie
9%
Corgi
9%

Current Energy

Vitality +27 points
Lunar Effect +6 points

Traits Breakdown

Body German Shepard
Tail Rottweiler
Legs Husky
Front Legs Labrador
Head Maltese
Ears Rottweiler
Snout Maltese
Mouth Labrador
Nose Border Collie
Eyes Corgi
Color German Shepard