Domino Doggon Cryptocurrency Dog - Mix of Husky, German Shepard, Poodle, Labrador, Maltese, Shiba Inu, Pug, Corgi and Pitbull terrier

Achievements

None
Domino Doggon
Domino Doggon here. Wanna play? I hate it when my humans fart and they blame me! I'm into recreational spankings and a little 'ruff' play. I've always wanted to be in commercials and be treated as the star I am! I'm trying to find a dog who'll let me stick my nose where I want, whenever I want.
  • Purity 3%
  • Age 55 days
  • Racing Exp 0
  • Husky 18%
  • 0 races
  • Gen 2
Share it to make him Happy!
Neutral & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACAGACACACCAACCGTATCAGAAAGCTCCTCA
A
C
A
G
A
C
A
C
A
C
C
A
A
C
C
G
T
A
T
C
A
G
A
A
A
G
C
T
C
C
T
C
A
Genes: 4I45KE72ON7

Composition

Husky
18%
German Shepard
18%
Poodle
9%
Labrador
9%
Maltese
9%
Shiba Inu
9%
Pug
9%
Corgi
9%
Pitbull terrier
9%

Current Energy

Vitality +22 points
Lunar Effect -14 points

Traits Breakdown

Body Husky
Tail Poodle
Legs Husky
Front Legs Labrador
Head Maltese
Ears Shiba Inu
Snout German Shepard
Mouth Pug
Nose Corgi
Eyes Pitbull terrier
Color German Shepard