Nfl Nellie Litecoin Game Dog - Mix of Husky, Pitbull terrier, Rottweiler, Poodle, Shiba Inu, Pug and Border Collie

Achievements

None
Nfl Nellie
Currently, I live on the information superhighway. Fences are just challenges...I don't let them stop me! My favorite dessert is licking the last of the ice cream from the carton. No chocolate, please. I love spending my days curled up in a cozy blanket with a nice, fresh bone to chew.
  • Purity 7%
  • Age 55 days
  • Racing Exp 0
  • Husky 27%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACAGACACATCCCACGTATCCCACGAAACATAC
A
C
A
G
A
C
A
C
A
T
C
C
C
A
C
G
T
A
T
C
C
C
A
C
G
A
A
A
C
A
T
A
C
Genes: 4I4NHENH24J

Composition

Husky
27%
Pitbull terrier
18%
Rottweiler
18%
Poodle
9%
Shiba Inu
9%
Pug
9%
Border Collie
9%

Current Energy

Vitality +22 points
Lunar Effect 0 points

Traits Breakdown

Body Husky
Tail Poodle
Legs Husky
Front Legs Pitbull terrier
Head Rottweiler
Ears Shiba Inu
Snout Pitbull terrier
Mouth Rottweiler
Nose Pug
Eyes Husky
Color Border Collie