Kaia Kallie Digital Cryptocurrency Dog - Mix of German Shepard, Pitbull terrier, Poodle, Husky, Golder Retriever, Pug, Shiba Inu, Labrador BK and Border Collie

Achievements

None
Kaia Kallie
Hullo. My name is Kaia Kallie. This dawg chases mice in a big data warehouse. I think it's unfair that the cat gets to poop in a box in the house, but I poop in a shoe ONE TIME and everybody freaks out!! As long as we are headed in the same direction, I say we try hanging out for a while.
  • Purity 3%
  • Age 52 days
  • Racing Exp 0
  • German Shepard 18%
  • 0 races
  • Gen 3
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCAGACACAAGATCCTCATCCGAAGTAGCATAC
T
C
A
G
A
C
A
C
A
A
G
A
T
C
C
T
C
A
T
C
C
G
A
A
G
T
A
G
C
A
T
A
C
Genes: 7I48N7N2E6J

Composition

German Shepard
18%
Pitbull terrier
18%
Poodle
9%
Husky
9%
Golder Retriever
9%
Pug
9%
Shiba Inu
9%
Labrador BK
9%
Border Collie
9%

Current Energy

Vitality +12 points
Lunar Effect -8 points

Traits Breakdown

Body German Shepard
Tail Poodle
Legs Husky
Front Legs Golder Retriever
Head Pitbull terrier
Ears German Shepard
Snout Pitbull terrier
Mouth Pug
Nose Shiba Inu
Eyes Labrador BK
Color Border Collie