Tardis Toyota Litecoin Dog - Mix of German Shepard, Labrador BK, St. Bernard, Grey Wolf, Rottweiler, Poodle and Corgi

Achievements

None
Tardis Toyota
I hate squeaky toys...when I finally get one to stop making that awful sound, my human buys another! Eat, sleep, poop. Honey, I've got it made. I pee when I'm excited. I enjoy finding and eating frozen cat turds in the winter. Bon appétit!
  • Purity 14%
  • Age 55 days
  • Racing Exp 0
  • German Shepard 36%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCATCATCATGACCCTCAGCACACGACAGCGCA
T
C
A
T
C
A
T
C
A
T
G
A
C
C
C
T
C
A
G
C
A
C
A
C
G
A
C
A
G
C
G
C
A
Genes: 777BL76HIO6

Composition

German Shepard
36%
Labrador BK
18%
St. Bernard
9%
Grey Wolf
9%
Rottweiler
9%
Poodle
9%
Corgi
9%

Current Energy

Vitality +9 points
Lunar Effect -24 points

Traits Breakdown

Body German Shepard
Tail German Shepard
Legs German Shepard
Front Legs St. Bernard
Head Grey Wolf
Ears German Shepard
Snout Labrador BK
Mouth Rottweiler
Nose Poodle
Eyes Corgi
Color Labrador BK