Judy Judy Digital Cryptocurrency Dog - Mix of Husky, Poodle, Pitbull terrier, Schnauzer, Pug, Beagle, German Shepard and Border Collie

Achievements

None
Judy Judy
Judy Judy is the name, love is my game. And fetch of course... Once I caught a seagull, but it scared me so I let it go. I like never worrying about my dog poo. I've got people for that. I'll be mostly faithful to you...if we can agree on a bootie-pass for that Taco Bell dog!
  • Purity 11%
  • Age 52 days
  • Racing Exp 0
  • Husky 36%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACAGACACAACATCCACAATAGAACTATCATAC
A
C
A
G
A
C
A
C
A
A
C
A
T
C
C
A
C
A
A
T
A
G
A
A
C
T
A
T
C
A
T
A
C
Genes: 4I44N4C2D7J

Composition

Husky
36%
Poodle
9%
Pitbull terrier
9%
Schnauzer
9%
Pug
9%
Beagle
9%
German Shepard
9%
Border Collie
9%

Current Energy

Vitality +13 points
Lunar Effect 0 points

Traits Breakdown

Body Husky
Tail Poodle
Legs Husky
Front Legs Husky
Head Pitbull terrier
Ears Husky
Snout Schnauzer
Mouth Pug
Nose Beagle
Eyes German Shepard
Color Border Collie