Mary Jane Moose Digital Cryptocurrency Dog - Mix of Husky, Pitbull terrier, German Shepard, Poodle, Labrador, Shiba Inu, Pug and Corgi

Achievements

None
Mary Jane Moose
Hello, I be Mary Jane Moose. My favorite position is doggie style ;) I think it's unfair that the cat gets to poop in a box in the house, but I poop in a shoe ONE TIME and everybody freaks out!! Fences are just challenges...I don't let them stop me! As a perfectionist, I have to find just the right 'spot'.
  • Purity 4%
  • Age 55 days
  • Racing Exp 0
  • Husky 18%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACAGACACACCATCCGTATCAGAAAGCTCCTCA
A
C
A
G
A
C
A
C
A
C
C
A
T
C
C
G
T
A
T
C
A
G
A
A
A
G
C
T
C
C
T
C
A
Genes: 4I45NE72ON7

Composition

Husky
18%
Pitbull terrier
18%
German Shepard
18%
Poodle
9%
Labrador
9%
Shiba Inu
9%
Pug
9%
Corgi
9%

Current Energy

Vitality +22 points
Lunar Effect -14 points

Traits Breakdown

Body Husky
Tail Poodle
Legs Husky
Front Legs Labrador
Head Pitbull terrier
Ears Shiba Inu
Snout German Shepard
Mouth Pug
Nose Corgi
Eyes Pitbull terrier
Color German Shepard