Ziggy Zerp Crypto Dog - Mix of Rottweiler, Husky, Labrador, Labrador BK, Poodle, Corgi, Beagle and German Shepard

Achievements

None
Ziggy Zerp
How do you do? I'm Ziggy Zerp. The internet's my home. Peanut butter is delish but I HATE when it sticks to the roof of my mouth. I love to find stinky things and roll in them. The stinkier, the better. Roadkill is my favorite! Getting out of a long relationship, not looking for another
  • Purity 4%
  • Age 52 days
  • Racing Exp 0
  • Rottweiler 18%
  • 0 races
  • Gen 3
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCACACACACCAGACACAAGCCCACTATCACAC
G
C
A
C
A
C
A
C
A
C
C
A
G
A
C
A
C
A
A
G
C
C
C
A
C
T
A
T
C
A
C
A
C
Genes: 6H45I4O5D7H

Composition

Rottweiler
18%
Husky
18%
Labrador
18%
Labrador BK
9%
Poodle
9%
Corgi
9%
Beagle
9%
German Shepard
9%

Current Energy

Vitality +17 points
Lunar Effect -4 points

Traits Breakdown

Body Labrador BK
Tail Rottweiler
Legs Husky
Front Legs Labrador
Head Poodle
Ears Husky
Snout Corgi
Mouth Labrador
Nose Beagle
Eyes German Shepard
Color Rottweiler