Boomer Birdo Bitcoin Dog - Mix of German Shepard, Husky, Shiba Inu, Corgi, Schnauzer, Pug, Beagle and Rottweiler

Achievements

None
Boomer Birdo
How goes it? I'm Boomer Birdo. I believe running along the beach to catch a stick can be nearly orgasmic. I'm willing to try little bondage, so my human chained me up! Of course, I'm micro-chipped. I'm up on all the latest tech gadgets. Blue toilet water turns me off.
  • Purity 6%
  • Age 55 days
  • Racing Exp 0
  • German Shepard 27%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCAGTAAGCACATCAACAATAGAACTATCACAC
T
C
A
G
T
A
A
G
C
A
C
A
T
C
A
A
C
A
A
T
A
G
A
A
C
T
A
T
C
A
C
A
C
Genes: 7EO474C2D7H

Composition

German Shepard
27%
Husky
18%
Shiba Inu
9%
Corgi
9%
Schnauzer
9%
Pug
9%
Beagle
9%
Rottweiler
9%

Current Energy

Vitality +14 points
Lunar Effect -8 points

Traits Breakdown

Body German Shepard
Tail Shiba Inu
Legs Corgi
Front Legs Husky
Head German Shepard
Ears Husky
Snout Schnauzer
Mouth Pug
Nose Beagle
Eyes German Shepard
Color Rottweiler