Belt Babbles Virtual Crypto Game Dog - Mix of Husky, Pitbull terrier, Labrador BK, Poodle, Pug, Beagle, Boxer and Rottweiler

Achievements

None
Belt Babbles
I feel totally safe lying naked on a rug in front of a digital fire, surrounded by firewalls. I am really into starting howling wars with the neighborhood dogs. I'm the loudest! Blue toilet water turns me off. I just want a snuggle buddy with a nice, soft coat.
  • Purity 8%
  • Age 55 days
  • Racing Exp 0
  • Husky 27%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCAGACACAACATCCACATCCGAACTAAACCAC
G
C
A
G
A
C
A
C
A
A
C
A
T
C
C
A
C
A
T
C
C
G
A
A
C
T
A
A
A
C
C
A
C
Genes: 6I44N4N2DGH

Composition

Husky
27%
Pitbull terrier
18%
Labrador BK
9%
Poodle
9%
Pug
9%
Beagle
9%
Boxer
9%
Rottweiler
9%

Current Energy

Vitality +17 points
Lunar Effect -4 points

Traits Breakdown

Body Labrador BK
Tail Poodle
Legs Husky
Front Legs Husky
Head Pitbull terrier
Ears Husky
Snout Pitbull terrier
Mouth Pug
Nose Beagle
Eyes Boxer
Color Rottweiler