Myrtle Merryweather Cryptocurrency Game Dog - Mix of Husky, Pitbull terrier, Shiba Inu, Border Collie, Pug, Boxer and Rottweiler

Achievements

None
Myrtle Merryweather
Myrtle Merryweather here. Wanna play? Why humans throw perfectly good things away is beyond me. I'm into recycling trash bin contents. I like to smell everything, but my favorite smell is freshly cut grass. I like to roll in it until my fur turns green! My human is my best friend, looking for someone who is okay with that.
  • Purity 12%
  • Age 55 days
  • Racing Exp 0
  • Husky 36%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACAGTAACAACATCCACATCCTACGAAAACCAC
A
C
A
G
T
A
A
C
A
A
C
A
T
C
C
A
C
A
T
C
C
T
A
C
G
A
A
A
A
C
C
A
C
Genes: 4E44N4NJ2GH

Composition

Husky
36%
Pitbull terrier
18%
Shiba Inu
9%
Border Collie
9%
Pug
9%
Boxer
9%
Rottweiler
9%

Current Energy

Vitality +15 points
Lunar Effect +4 points

Traits Breakdown

Body Husky
Tail Shiba Inu
Legs Husky
Front Legs Husky
Head Pitbull terrier
Ears Husky
Snout Pitbull terrier
Mouth Border Collie
Nose Pug
Eyes Boxer
Color Rottweiler