Rhett Rolls Royce Cryptocurrency Game Dog - Mix of Husky, Corgi, Beagle, Labrador, Shiba Inu, German Shepard, Pug, Rottweiler and Boxer

Achievements

None
Rhett Rolls Royce
I'd like to take you for a byte to eat in cyberspace. I like to work out by digging fresh holes in landscaped yards. Blue toilet water turns me off. When I can get it, my favorite meal is pepperoni pizza and Milk-Bones. If you are looking for companionship without commitment, keep looking.
  • Purity 3%
  • Age 55 days
  • Racing Exp 0
  • Husky 18%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACACTAACACCAAGCGTATCAGAACACAACAGC
A
C
A
C
T
A
A
C
A
C
C
A
A
G
C
G
T
A
T
C
A
G
A
A
C
A
C
A
A
C
A
G
C
Genes: 4D45OE72HGO

Composition

Husky
18%
Corgi
18%
Beagle
9%
Labrador
9%
Shiba Inu
9%
German Shepard
9%
Pug
9%
Rottweiler
9%
Boxer
9%

Current Energy

Vitality +22 points
Lunar Effect -4 points

Traits Breakdown

Body Husky
Tail Beagle
Legs Husky
Front Legs Labrador
Head Corgi
Ears Shiba Inu
Snout German Shepard
Mouth Pug
Nose Rottweiler
Eyes Boxer
Color Corgi