Barclay Baron Litecoin Dog - Mix of Husky, Pitbull terrier, Shiba Inu, Border Collie, Pug, German Shepard and Rottweiler

Achievements

None
Barclay Baron
What's up? I'm Barclay Baron. Virtually, I'll come whenever you call. Small yappy creatures bug me...they disturb my zen. Hound Dog by Elvis is probably the best song ever written. If you are looking for a pooch who's in touch with feelings, here I am.
  • Purity 12%
  • Age 52 days
  • Racing Exp 0
  • Husky 36%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACAGTAACAACATCCACATCCTACGAATCACAC
A
C
A
G
T
A
A
C
A
A
C
A
T
C
C
A
C
A
T
C
C
T
A
C
G
A
A
T
C
A
C
A
C
Genes: 4E44N4NJ27H

Composition

Husky
36%
Pitbull terrier
18%
Shiba Inu
9%
Border Collie
9%
Pug
9%
German Shepard
9%
Rottweiler
9%

Current Energy

Vitality +13 points
Lunar Effect 0 points

Traits Breakdown

Body Husky
Tail Shiba Inu
Legs Husky
Front Legs Husky
Head Pitbull terrier
Ears Husky
Snout Pitbull terrier
Mouth Border Collie
Nose Pug
Eyes German Shepard
Color Rottweiler