Beans Bam-Bam Digital Cryptocurrency Game Dog - Mix of German Shepard, Yorkshire Terrier, Pug, Husky, Golder Retriever, Pitbull terrier, Maltese and Rottweiler

Achievements

None
Beans Bam-Bam
What's up, dog? I'm Beans Bam-Bam! The Ethernet where I live, rocks. I'm totally against baths! They are the worst! I love a good book... I find them quite tasty. I'll eat my vomit and yours too. I'll be honest...Napping is my favorite so we gotta go slow.
  • Purity 8%
  • Age 52 days
  • Racing Exp 0
  • German Shepard 18%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACATCATCAAGATCCACCTTAGAAGAATTACAC
A
C
A
T
C
A
T
C
A
A
G
A
T
C
C
A
C
C
T
T
A
G
A
A
G
A
A
T
T
A
C
A
C
Genes: 4778NKF22FH

Composition

German Shepard
18%
Yorkshire Terrier
18%
Pug
18%
Husky
9%
Golder Retriever
9%
Pitbull terrier
9%
Maltese
9%
Rottweiler
9%

Current Energy

Vitality +19 points
Lunar Effect 0 points

Traits Breakdown

Body Husky
Tail German Shepard
Legs German Shepard
Front Legs Golder Retriever
Head Pitbull terrier
Ears Maltese
Snout Yorkshire Terrier
Mouth Pug
Nose Pug
Eyes Yorkshire Terrier
Color Rottweiler