Aqua Austin Litecoin Dog - Mix of Boxer, Maltese, Shiba Inu, Beagle, Rottweiler, Yorkshire Terrier, Poodle and St. Bernard

Achievements

None
Aqua Austin
I don't mind sharing my bed with someone I just met, if we can cuddle. I don't appreciate being around bores who bark too much. My human's feet are definitely the greatest smell ever. Especially after a long day at work! I love connecting with my friends via pee-mail.
  • Purity 6%
  • Age 4 months
  • Racing Exp 0
  • Boxer 27%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AACACCGTACTACACAACTTAACCAACGACTGA
A
A
C
A
C
C
G
T
A
C
T
A
C
A
C
A
A
C
T
T
A
A
C
C
A
A
C
G
A
C
T
G
A
Genes: GKEDHGFKGIB

Composition

Boxer
27%
Maltese
18%
Shiba Inu
9%
Beagle
9%
Rottweiler
9%
Yorkshire Terrier
9%
Poodle
9%
St. Bernard
9%

Current Energy

Vitality -41 points
Lunar Effect -8 points

Traits Breakdown

Body Boxer
Tail Maltese
Legs Shiba Inu
Front Legs Beagle
Head Rottweiler
Ears Boxer
Snout Yorkshire Terrier
Mouth Maltese
Nose Boxer
Eyes Poodle
Color St. Bernard