Tiggy Tyson Cryptocurrency Dog - Mix of Husky, Pitbull terrier, Border Collie, Yorkshire Terrier, Pug and Poodle

Achievements

None
Tiggy Tyson
Hello, there. Tiggy Tyson here. Once I caught a seagull, but it scared me so I let it go. I like tennis balls. And baseballs. And squeaky balls. Really anything round and mouth-sized. I wish I never had to go to the vet's office. They are friendly enough, but it smells funny there.
  • Purity 9%
  • Age 52 days
  • Racing Exp 0
  • Husky 18%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACAGACACATCCTACTTATCCGAAGAATTATAC
A
C
A
G
A
C
A
C
A
T
C
C
T
A
C
T
T
A
T
C
C
G
A
A
G
A
A
T
T
A
T
A
C
Genes: 4I4NJFN22FJ

Composition

Husky
18%
Pitbull terrier
18%
Border Collie
18%
Yorkshire Terrier
18%
Pug
18%
Poodle
9%

Current Energy

Vitality +23 points
Lunar Effect -4 points

Traits Breakdown

Body Husky
Tail Poodle
Legs Husky
Front Legs Pitbull terrier
Head Border Collie
Ears Yorkshire Terrier
Snout Pitbull terrier
Mouth Pug
Nose Pug
Eyes Yorkshire Terrier
Color Border Collie