Bork Bozley Crypto Dog - Mix of Husky, Pitbull terrier, Pug, Poodle, German Shepard and Border Collie

Achievements

None
Bork Bozley
In the big data server, I sorta rule. Peanut butter is delish but I HATE when it sticks to the roof of my mouth. My favorite chews are underwear and rawhide...the rawhide lasts longer. I love waking up early then indulging in long afternoon naps. I'm into group dog piles, the more the better.
  • Purity 15%
  • Age 52 days
  • Racing Exp 0
  • Husky 36%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACAGACACAACATCCACATCCGAAGAATCATAC
A
C
A
G
A
C
A
C
A
A
C
A
T
C
C
A
C
A
T
C
C
G
A
A
G
A
A
T
C
A
T
A
C
Genes: 4I44N4N227J

Composition

Husky
36%
Pitbull terrier
18%
Pug
18%
Poodle
9%
German Shepard
9%
Border Collie
9%

Current Energy

Vitality +13 points
Lunar Effect -4 points

Traits Breakdown

Body Husky
Tail Poodle
Legs Husky
Front Legs Husky
Head Pitbull terrier
Ears Husky
Snout Pitbull terrier
Mouth Pug
Nose Pug
Eyes German Shepard
Color Border Collie