Gertrude Geppetto Bitcoin Game Dog - Mix of Husky, Pitbull terrier, German Shepard, Pug, Poodle, Labrador and Shiba Inu

Achievements

None
Gertrude Geppetto
Hi! My name is Gertrude Geppetto. I feel totally safe lying naked on a rug in front of a digital fire, surrounded by firewalls. I dislike anyone messing with my toys. They are MY toys. But I'd be willing to share with the right partner ;) I am looking for my best friend, lover, and equal partner to share my food bowl.
  • Purity 8%
  • Age 52 days
  • Racing Exp 0
  • Husky 18%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACAGACACACCATCCGTATCAGAAGAATCCTCA
A
C
A
G
A
C
A
C
A
C
C
A
T
C
C
G
T
A
T
C
A
G
A
A
G
A
A
T
C
C
T
C
A
Genes: 4I45NE722N7

Composition

Husky
18%
Pitbull terrier
18%
German Shepard
18%
Pug
18%
Poodle
9%
Labrador
9%
Shiba Inu
9%

Current Energy

Vitality +25 points
Lunar Effect -4 points

Traits Breakdown

Body Husky
Tail Poodle
Legs Husky
Front Legs Labrador
Head Pitbull terrier
Ears Shiba Inu
Snout German Shepard
Mouth Pug
Nose Pug
Eyes Pitbull terrier
Color German Shepard