Tani Tiana Crypto Game Dog - Mix of Border Collie, Pitbull terrier, Pug, Poodle, St. Bernard, Dachshund and Husky

Achievements

None
Tani Tiana
Let me introduce myself, I'm Tani Tiana. I love licking faces! Little humans are my favorite because they usually have some good food smeared all over them! My favorite movie is Dog Day Afternoon. I've never seen it but I like the title! I hate having to share my food dish...
  • Purity 11%
  • Age 55 days
  • Racing Exp 0
  • Border Collie 27%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACGACTACTCCTGAGGATCCGAAGAAACATAC
T
A
C
G
A
C
T
A
C
T
C
C
T
G
A
G
G
A
T
C
C
G
A
A
G
A
A
A
C
A
T
A
C
Genes: JIJNBAN224J

Composition

Border Collie
27%
Pitbull terrier
18%
Pug
18%
Poodle
9%
St. Bernard
9%
Dachshund
9%
Husky
9%

Current Energy

Vitality +21 points
Lunar Effect +4 points

Traits Breakdown

Body Border Collie
Tail Poodle
Legs Border Collie
Front Legs Pitbull terrier
Head St. Bernard
Ears Dachshund
Snout Pitbull terrier
Mouth Pug
Nose Pug
Eyes Husky
Color Border Collie