Bugsey Bentley Digital Cryptocurrency Dog - Mix of Husky, Pitbull terrier, Border Collie, Shiba Inu, Labrador, Corgi and Pug

Achievements

None
Bugsey Bentley
I make the best virtual pet. Power outages and computer viruses scare me! My favorite thing to do is go to the pet store with my human. All the other humans pet me and I get to pick out a new toy! I need to find someone tuff to help me protect our pups from that scheming mailman!
  • Purity 7%
  • Age 52 days
  • Racing Exp 0
  • Husky 27%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACAGTAACACCATCCAGCTACTCCGAAACATAC
A
C
A
G
T
A
A
C
A
C
C
A
T
C
C
A
G
C
T
A
C
T
C
C
G
A
A
A
C
A
T
A
C
Genes: 4E45NOJN24J

Composition

Husky
27%
Pitbull terrier
18%
Border Collie
18%
Shiba Inu
9%
Labrador
9%
Corgi
9%
Pug
9%

Current Energy

Vitality +25 points
Lunar Effect 0 points

Traits Breakdown

Body Husky
Tail Shiba Inu
Legs Husky
Front Legs Labrador
Head Pitbull terrier
Ears Corgi
Snout Border Collie
Mouth Pitbull terrier
Nose Pug
Eyes Husky
Color Border Collie