Bigs Bully Litecoin Dog - Mix of Labrador, Pug, Grey Wolf, Rottweiler, Maltese, Boxer and Husky

Achievements

None
Bigs Bully
If you'd like to get together, I'm Bigs Bully. I hate it when I am not the center of attention. My favorite movie is Dog Day Afternoon. I've never seen it but I like the title! I cry whenever I hear an ambulance siren! I like tennis balls. And baseballs. And squeaky balls. Really anything round and mouth-sized.
  • Purity 14%
  • Age 52 days
  • Racing Exp 0
  • Labrador 27%
  • 0 races
  • Gen 3
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCACCACCACCCGAACACACCGAAGAAAACACA
C
C
A
C
C
A
C
C
A
C
C
C
G
A
A
C
A
C
A
C
C
G
A
A
G
A
A
A
A
C
A
C
A
Genes: 555L2HK22G4

Composition

Labrador
27%
Pug
27%
Grey Wolf
9%
Rottweiler
9%
Maltese
9%
Boxer
9%
Husky
9%

Current Energy

Vitality +32 points
Lunar Effect 0 points

Traits Breakdown

Body Labrador
Tail Labrador
Legs Labrador
Front Legs Grey Wolf
Head Pug
Ears Rottweiler
Snout Maltese
Mouth Pug
Nose Pug
Eyes Boxer
Color Husky