Theodora Tanner Bitcoin Dog - Mix of Pug, German Shepard, Schnauzer, Husky, St. Bernard, Border Collie and Labrador

Achievements

None
Theodora Tanner
I run with a pack in the data warehouse. I'm willing to try little bondage, so my human chained me up! I don't like running outta pee when there are still so many trees. I enjoy mixing it up once in a while by visiting different dog parks. I just want a snuggle buddy with a nice, soft coat.
  • Purity 12%
  • Age 52 days
  • Racing Exp 0
  • Pug 36%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCAGAAATAGAATCAACAGAAGAATGATACCCA
T
C
A
G
A
A
A
T
A
G
A
A
T
C
A
A
C
A
G
A
A
G
A
A
T
G
A
T
A
C
C
C
A
Genes: 72C27422BJ5

Composition

Pug
36%
German Shepard
18%
Schnauzer
9%
Husky
9%
St. Bernard
9%
Border Collie
9%
Labrador
9%

Current Energy

Vitality +4 points
Lunar Effect +8 points

Traits Breakdown

Body German Shepard
Tail Pug
Legs Schnauzer
Front Legs Pug
Head German Shepard
Ears Husky
Snout Pug
Mouth Pug
Nose St. Bernard
Eyes Border Collie
Color Labrador