Molly Miss Kitty Crypto Dog - Mix of Labrador, Poodle, Corgi, Labrador BK, Rottweiler, Husky, French Bulldog and Boxer

Achievements

None
Molly Miss Kitty
Hi! I'm Molly Miss Kitty! I love barking all night when others try to sleep. I hate it when my humans fool me with a pill in peanut butter! I'm into leather...if I have the right partner. It's okay with me just to touch paws while we watch t.v. on the couch if you want to start slow.
  • Purity 6%
  • Age 55 days
  • Racing Exp 0
  • Labrador 18%
  • 0 races
  • Gen 2
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCACACACACCAGACGACAGCCCAAGCCGAAAC
G
C
A
C
A
C
A
C
A
C
C
A
G
A
C
G
A
C
A
G
C
C
C
A
A
G
C
C
G
A
A
A
C
Genes: 6H45IIO5O9G

Composition

Labrador
18%
Poodle
18%
Corgi
18%
Labrador BK
9%
Rottweiler
9%
Husky
9%
French Bulldog
9%
Boxer
9%

Current Energy

Vitality +19 points
Lunar Effect -16 points

Traits Breakdown

Body Labrador BK
Tail Rottweiler
Legs Husky
Front Legs Labrador
Head Poodle
Ears Poodle
Snout Corgi
Mouth Labrador
Nose Corgi
Eyes French Bulldog
Color Boxer