Ted Ted Bitcoin Game Dog - Mix of Husky, Labrador BK, Shiba Inu, Corgi, Dachshund, St. Bernard, Border Collie, Beagle, Pug and Yorkshire Terrier

Achievements

None
Ted Ted
I love fetching anything my human throws! I'm not a fan of sleeping on the floor. This body was made for cuddles! I think hamsters and cats are both over-rated. The place I like most in the world is curled up in my human's bed, hogging all the covers!
  • Purity 1%
  • Age 55 days
  • Racing Exp 0
  • Husky 18%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCAGTAAGCACAGGAACATGATACCTAGAATTA
G
C
A
G
T
A
A
G
C
A
C
A
G
G
A
A
C
A
T
G
A
T
A
C
C
T
A
G
A
A
T
T
A
Genes: 6EO4A4BJD2F

Composition

Husky
18%
Labrador BK
9%
Shiba Inu
9%
Corgi
9%
Dachshund
9%
St. Bernard
9%
Border Collie
9%
Beagle
9%
Pug
9%
Yorkshire Terrier
9%

Current Energy

Vitality +7 points
Lunar Effect +4 points

Traits Breakdown

Body Labrador BK
Tail Shiba Inu
Legs Corgi
Front Legs Husky
Head Dachshund
Ears Husky
Snout St. Bernard
Mouth Border Collie
Nose Beagle
Eyes Pug
Color Yorkshire Terrier