Al Bundy Aphrodite Crypto Dog - Mix of Husky, Pitbull terrier, Pug, Poodle, Golder Retriever, Shiba Inu, Boxer and Border Collie

Achievements

None
Al Bundy Aphrodite
My name is Al Bundy Aphrodite and I'd really like to sniff you. I've been known to take mega bytes when playing ruff. I don't like to be ignored. I really enjoy heavy petting. I don't mind sharing my bed with someone I just met, if we can cuddle. I'll be honest...Napping is my favorite so we gotta go slow.
  • Purity 6%
  • Age 55 days
  • Racing Exp 0
  • Husky 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACAGACACAAGATCCGTATCCGAAGAAAACTAC
A
C
A
G
A
C
A
C
A
A
G
A
T
C
C
G
T
A
T
C
C
G
A
A
G
A
A
A
A
C
T
A
C
Genes: 4I48NEN22GJ

Composition

Husky
18%
Pitbull terrier
18%
Pug
18%
Poodle
9%
Golder Retriever
9%
Shiba Inu
9%
Boxer
9%
Border Collie
9%

Current Energy

Vitality +18 points
Lunar Effect 0 points

Traits Breakdown

Body Husky
Tail Poodle
Legs Husky
Front Legs Golder Retriever
Head Pitbull terrier
Ears Shiba Inu
Snout Pitbull terrier
Mouth Pug
Nose Pug
Eyes Boxer
Color Border Collie