Flounder Frosty Bitcoin Dog - Mix of Rottweiler, Pitbull terrier, Husky, Border Collie, Beagle, Corgi, Labrador BK and Boxer

Achievements

None
Flounder Frosty
Hey dawg! I'm Flounder Frosty. My favorite treat is to steal the pepperoni off of pizza. I am on a mission to sniff all the butts in the world. ALL the butts. I hate having to share my food dish... Too much steak gives me the runs! I 'm here for something RUFF ;)
  • Purity 6%
  • Age 55 days
  • Racing Exp 0
  • Rottweiler 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CACTCCTACCTATCCAGCACAGCAAACACACAC
C
A
C
T
C
C
T
A
C
C
T
A
T
C
C
A
G
C
A
C
A
G
C
A
A
A
C
A
C
A
C
A
C
Genes: HNJDNO46G4H

Composition

Rottweiler
18%
Pitbull terrier
18%
Husky
18%
Border Collie
9%
Beagle
9%
Corgi
9%
Labrador BK
9%
Boxer
9%

Current Energy

Vitality +5 points
Lunar Effect +4 points

Traits Breakdown

Body Rottweiler
Tail Pitbull terrier
Legs Border Collie
Front Legs Beagle
Head Pitbull terrier
Ears Corgi
Snout Husky
Mouth Labrador BK
Nose Boxer
Eyes Husky
Color Rottweiler