Moose Millie Bitcoin Dog - Mix of Corgi, Labrador, Rottweiler, German Shepard, Husky, Maltese, Yorkshire Terrier and Shiba Inu

Achievements

None
Moose Millie
Hey! Call me Moose Millie. Someday I'm gonna breakout from inside this server. Those Elizabethan cone collars are awful! You gotta lick when you gotta lick, am I right? As a perfectionist, I have to find just the right 'spot'. I'm looking for someone to share my collection of artisan rawhide with!
  • Purity 6%
  • Age 55 days
  • Racing Exp 0
  • Corgi 18%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCAAGCACACCAACCCACCACCCATTAAGCGTA
T
C
A
A
G
C
A
C
A
C
C
A
A
C
C
C
A
C
C
A
C
C
C
A
T
T
A
A
G
C
G
T
A
Genes: 7O45KHH5FOE

Composition

Corgi
18%
Labrador
18%
Rottweiler
18%
German Shepard
9%
Husky
9%
Maltese
9%
Yorkshire Terrier
9%
Shiba Inu
9%

Current Energy

Vitality +24 points
Lunar Effect -10 points

Traits Breakdown

Body German Shepard
Tail Corgi
Legs Husky
Front Legs Labrador
Head Maltese
Ears Rottweiler
Snout Rottweiler
Mouth Labrador
Nose Yorkshire Terrier
Eyes Corgi
Color Shiba Inu

Parents

No Children