Deuce Deuce Bitcoin Dog - Mix of Husky, Rottweiler, Labrador BK, Border Collie, Maltese, Labrador, Yorkshire Terrier and German Shepard

Achievements

None
Deuce Deuce
Hi! My name is Deuce Deuce. Ima Ethernet dog. Bones I let age in the dirt develop my favorite flavor, but I don't recommend that with Oreos. I don't understand why my human tries to give me tap water. I expect filtered and distilled! Finding the 'one' out of the pack that I can spend my life with...that's what I want.
  • Purity 8%
  • Age 55 days
  • Racing Exp 0
  • Husky 27%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCACACACAACATACACAACCCCATTATCACAC
G
C
A
C
A
C
A
C
A
A
C
A
T
A
C
A
C
A
A
C
C
C
C
A
T
T
A
T
C
A
C
A
C
Genes: 6H44J4K5F7H

Composition

Husky
27%
Rottweiler
18%
Labrador BK
9%
Border Collie
9%
Maltese
9%
Labrador
9%
Yorkshire Terrier
9%
German Shepard
9%

Current Energy

Vitality +27 points
Lunar Effect -8 points

Traits Breakdown

Body Labrador BK
Tail Rottweiler
Legs Husky
Front Legs Husky
Head Border Collie
Ears Husky
Snout Maltese
Mouth Labrador
Nose Yorkshire Terrier
Eyes German Shepard
Color Rottweiler