Mackenzie Mila Litecoin Game Dog - Mix of Labrador, Corgi, Yorkshire Terrier, Pitbull terrier, St. Bernard, Pug, German Shepard and Rottweiler

Achievements

None
Mackenzie Mila
Mackenzie Mila here, let's shake. I hate bubble baths; mud puddles are more my style. I'm a serial monogamist. I like exploring off leash best. You'll find me walking into my favorite pet store like I own the place. I do, don't I?
  • Purity 6%
  • Age 55 days
  • Racing Exp 0
  • Labrador 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TTACCATCCCCAAGCTGAGAATCACACCCAAGC
T
T
A
C
C
A
T
C
C
C
C
A
A
G
C
T
G
A
G
A
A
T
C
A
C
A
C
C
C
A
A
G
C
Genes: F5N5OB27H5O

Composition

Labrador
27%
Corgi
18%
Yorkshire Terrier
9%
Pitbull terrier
9%
St. Bernard
9%
Pug
9%
German Shepard
9%
Rottweiler
9%

Current Energy

Vitality +2 points
Lunar Effect -12 points

Traits Breakdown

Body Yorkshire Terrier
Tail Labrador
Legs Pitbull terrier
Front Legs Labrador
Head Corgi
Ears St. Bernard
Snout Pug
Mouth German Shepard
Nose Rottweiler
Eyes Labrador
Color Corgi