Walter Waldo Cryptocurrency Game Dog - Mix of German Shepard, Pitbull terrier, Border Collie, Husky, Maltese, Labrador BK, St. Bernard and Shiba Inu

Achievements

None
Walter Waldo
I was born in the web cloud. I like exploring off leash best. My favorite place in the world is the dog park. So many smells! I'm terrified of the big, loud, metal creature with people inside that picks up the trash every week. It's really scary! Sometimes I just have to roll in something dead.
  • Purity 4%
  • Age 52 days
  • Racing Exp 0
  • German Shepard 18%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCAACAACCGCATCATCCTACTGAGTATACTCC
T
C
A
A
C
A
A
C
C
G
C
A
T
C
A
T
C
C
T
A
C
T
G
A
G
T
A
T
A
C
T
C
C
Genes: 74K67NJBEJN

Composition

German Shepard
18%
Pitbull terrier
18%
Border Collie
18%
Husky
9%
Maltese
9%
Labrador BK
9%
St. Bernard
9%
Shiba Inu
9%

Current Energy

Vitality +21 points
Lunar Effect +8 points

Traits Breakdown

Body German Shepard
Tail Husky
Legs Maltese
Front Legs Labrador BK
Head German Shepard
Ears Pitbull terrier
Snout Border Collie
Mouth St. Bernard
Nose Shiba Inu
Eyes Border Collie
Color Pitbull terrier