Lakin Lucifer Bitcoin Dog - Mix of Border Collie, Labrador, Husky, French Bulldog, Pitbull terrier, Golder Retriever and Beagle

Achievements

None
Lakin Lucifer
Well hello, beautiful. My name's Lakin Lucifer. I'm not a bad dog, my data is just configured that way. Slipping my collar, running off and making my humans worried? Every chance I get. I hate it when other dogs pee in my yard! IT'S MY YARD!! Dragging my butt on the carpet feels so good.
  • Purity 11%
  • Age 52 days
  • Racing Exp 0
  • Border Collie 27%
  • 0 races
  • Gen 3
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACATACCCACCACGACCATACTCCAGATACCTA
A
C
A
T
A
C
C
C
A
C
C
A
C
G
A
C
C
A
T
A
C
T
C
C
A
G
A
T
A
C
C
T
A
Genes: 4J5595JN8JD

Composition

Border Collie
27%
Labrador
27%
Husky
9%
French Bulldog
9%
Pitbull terrier
9%
Golder Retriever
9%
Beagle
9%

Current Energy

Vitality +32 points
Lunar Effect -8 points

Traits Breakdown

Body Husky
Tail Border Collie
Legs Labrador
Front Legs Labrador
Head French Bulldog
Ears Labrador
Snout Border Collie
Mouth Pitbull terrier
Nose Golder Retriever
Eyes Border Collie
Color Beagle