Shorty Scotty Crypto Game Dog - Mix of German Shepard, Grey Wolf, Yorkshire Terrier, Husky, Border Collie, Boxer, St. Bernard and Schnauzer

Achievements

None
Shorty Scotty
Sup? ;-) I'm Shorty Scotty. Currently, I live on the information superhighway. I pee when I'm excited. I don't like to be ignored. Creativity is my middle name... I turn everything in to a chew toy. I'd like to leave my paw prints in the sand next to yours on a moonlit beach.
  • Purity 4%
  • Age 52 days
  • Racing Exp 0
  • German Shepard 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCAACACCCTACTCATTAAACCCCTGATTAATA
T
C
A
A
C
A
C
C
C
T
A
C
T
C
A
T
T
A
A
A
C
C
C
C
T
G
A
T
T
A
A
T
A
Genes: 74LJ7FGLBFC

Composition

German Shepard
18%
Grey Wolf
18%
Yorkshire Terrier
18%
Husky
9%
Border Collie
9%
Boxer
9%
St. Bernard
9%
Schnauzer
9%

Current Energy

Vitality +39 points
Lunar Effect +2 points

Traits Breakdown

Body German Shepard
Tail Husky
Legs Grey Wolf
Front Legs Border Collie
Head German Shepard
Ears Yorkshire Terrier
Snout Boxer
Mouth Grey Wolf
Nose St. Bernard
Eyes Yorkshire Terrier
Color Schnauzer