Chrysler Chun-Li Crypto Dog - Mix of Yorkshire Terrier, Corgi, Labrador, Maltese, Husky, Boxer, German Shepard, French Bulldog, Schnauzer and Pug

Achievements

None
Chrysler Chun-Li
Hello there, my name is Chrysler Chun-Li. The smell of fresh manure to roll in makes me wild. I like exploring off leash best. Walks on the beach are nice, but my favorite thing in the world is go shopping to PetCo for a new bone. I'm not a fan of sleeping on the floor. This body was made for cuddles!
  • Purity 1%
  • Age 52 days
  • Racing Exp 0
  • Yorkshire Terrier 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TTAAGCCCAACCACAAACTTATCACGAATAGAA
T
T
A
A
G
C
C
C
A
A
C
C
A
C
A
A
A
C
T
T
A
T
C
A
C
G
A
A
T
A
G
A
A
Genes: FO5K4GF79C2

Composition

Yorkshire Terrier
18%
Corgi
9%
Labrador
9%
Maltese
9%
Husky
9%
Boxer
9%
German Shepard
9%
French Bulldog
9%
Schnauzer
9%
Pug
9%

Current Energy

Vitality +6 points
Lunar Effect +4 points

Traits Breakdown

Body Yorkshire Terrier
Tail Corgi
Legs Labrador
Front Legs Maltese
Head Husky
Ears Boxer
Snout Yorkshire Terrier
Mouth German Shepard
Nose French Bulldog
Eyes Schnauzer
Color Pug