Gouken Geppetto Bitcoin Dog - Mix of Yorkshire Terrier, Labrador BK, Border Collie, Pitbull terrier, Maltese, Corgi, St. Bernard and Rottweiler

Achievements

None
Gouken Geppetto
I don't understand why my human tries to give me tap water. I expect filtered and distilled! I'm a gourmand...my favorite dish is that dry food that makes it's own gravy! I enjoy finding and eating frozen cat turds in the winter. Bon appétit! It turns me on when I can show an older dog a new trick.
  • Purity 6%
  • Age 2 months
  • Racing Exp 0
  • Yorkshire Terrier 18%
  • 0 races
  • Gen 2
Share it to make him Happy!
Neutral & Tardy
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCCTTAACCGCAGCAAGCTGATACCACTACTTA
T
C
C
T
T
A
A
C
C
G
C
A
G
C
A
A
G
C
T
G
A
T
A
C
C
A
C
T
A
C
T
T
A
Genes: NFK66OBJHJF

Composition

Yorkshire Terrier
18%
Labrador BK
18%
Border Collie
18%
Pitbull terrier
9%
Maltese
9%
Corgi
9%
St. Bernard
9%
Rottweiler
9%

Current Energy

Vitality -10 points
Lunar Effect +4 points

Traits Breakdown

Body Pitbull terrier
Tail Yorkshire Terrier
Legs Maltese
Front Legs Labrador BK
Head Labrador BK
Ears Corgi
Snout St. Bernard
Mouth Border Collie
Nose Rottweiler
Eyes Border Collie
Color Yorkshire Terrier