Joker Jelly Crypto Dog - Mix of Husky, Pug, Beagle, Shiba Inu, Maltese, Rottweiler and German Shepard

Achievements

None
Joker Jelly
Hola! My name is Joker Jelly. Ima Ethernet dog. I hate going to the vet and will do almost anything to avoid it. I'm into group dog piles, the more the better. Long, leisurely walks to catch up on my pee-mail is my favorite thing on Sundays. I just want to "share a bone"... ;)
  • Purity 9%
  • Age 52 days
  • Racing Exp 0
  • Husky 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GTAGAAACACTAACCACAACACACTCACTAGAA
G
T
A
G
A
A
A
C
A
C
T
A
A
C
C
A
C
A
A
C
A
C
A
C
T
C
A
C
T
A
G
A
A
Genes: E24DK44H7D2

Composition

Husky
27%
Pug
18%
Beagle
18%
Shiba Inu
9%
Maltese
9%
Rottweiler
9%
German Shepard
9%

Current Energy

Vitality -1 points
Lunar Effect +4 points

Traits Breakdown

Body Shiba Inu
Tail Pug
Legs Husky
Front Legs Beagle
Head Maltese
Ears Husky
Snout Husky
Mouth Rottweiler
Nose German Shepard
Eyes Beagle
Color Pug

Parents

No Children