Patty Pete Bitcoin Dog - Mix of Pitbull terrier, Boxer, Pug, Labrador, Labrador BK, St. Bernard, Husky and Rottweiler

Achievements

None
Patty Pete
I enjoy crunchy kibble and drinking from toilets. Power outages and computer viruses scare me! As a designer, I suggest low windows or couch backs next to windows without curtains. I'll eat my vomit and yours too.
  • Purity 8%
  • Age 4 months
  • Racing Exp 0
  • Pitbull terrier 27%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCCTCCGAACCATCCGCAAACTGAACAAACCAC
T
C
C
T
C
C
G
A
A
C
C
A
T
C
C
G
C
A
A
A
C
T
G
A
A
C
A
A
A
C
C
A
C
Genes: NN25N6GB4GH

Composition

Pitbull terrier
27%
Boxer
18%
Pug
9%
Labrador
9%
Labrador BK
9%
St. Bernard
9%
Husky
9%
Rottweiler
9%

Current Energy

Vitality -41 points
Lunar Effect 0 points

Traits Breakdown

Body Pitbull terrier
Tail Pitbull terrier
Legs Pug
Front Legs Labrador
Head Pitbull terrier
Ears Labrador BK
Snout Boxer
Mouth St. Bernard
Nose Husky
Eyes Boxer
Color Rottweiler

Parents

No Children