Han Solo Hercules Digital Cryptocurrency Dog - Mix of Corgi, Labrador BK, Pitbull terrier, German Shepard, Maltese, Border Collie, St. Bernard and Dachshund

Achievements

None
Han Solo Hercules
Baby, I'm made from the same stuff as dreams. I wish I could spend every weekend going camping with my human. All the animals out there smell so funny! I prefer lounging around the house. Nothing beats the midday sunbeam on the couch! I wish I never had to go to the vet's office. They are friendly enough, but it smells funny there.
  • Purity 6%
  • Age 55 days
  • Racing Exp 0
  • Corgi 18%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCAAGCACCGCAGCATACTCCTGAAGCGGATCC
T
C
A
A
G
C
A
C
C
G
C
A
G
C
A
T
A
C
T
C
C
T
G
A
A
G
C
G
G
A
T
C
C
Genes: 7OK66JNBOAN

Composition

Corgi
18%
Labrador BK
18%
Pitbull terrier
18%
German Shepard
9%
Maltese
9%
Border Collie
9%
St. Bernard
9%
Dachshund
9%

Current Energy

Vitality +7 points
Lunar Effect -6 points

Traits Breakdown

Body German Shepard
Tail Corgi
Legs Maltese
Front Legs Labrador BK
Head Labrador BK
Ears Border Collie
Snout Pitbull terrier
Mouth St. Bernard
Nose Corgi
Eyes Dachshund
Color Pitbull terrier

Parents

No Children