Slink Snickers Crypto Dog - Mix of Border Collie, St. Bernard, Beagle, Pitbull terrier, Yorkshire Terrier, Labrador BK, German Shepard and Pug

Achievements

None
Slink Snickers
Hey! My name's Slink Snickers! Ever play 'catch' with two humans then it turns into 'keep away'? Hate that. I think swimming is pretty much the most fun thing ever. Pools, lakes, ponds, even slightly large puddles on the sidewalk! I am looking for dogs I can run around town with...not looking for exclusivity.
  • Purity 4%
  • Age 52 days
  • Racing Exp 0
  • Border Collie 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Quick
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACTGATACTCCCTATTATGAGCATCACTAGAA
T
A
C
T
G
A
T
A
C
T
C
C
C
T
A
T
T
A
T
G
A
G
C
A
T
C
A
C
T
A
G
A
A
Genes: JBJNDFB67D2

Composition

Border Collie
18%
St. Bernard
18%
Beagle
18%
Pitbull terrier
9%
Yorkshire Terrier
9%
Labrador BK
9%
German Shepard
9%
Pug
9%

Current Energy

Vitality +9 points
Lunar Effect +6 points

Traits Breakdown

Body Border Collie
Tail St. Bernard
Legs Border Collie
Front Legs Pitbull terrier
Head Beagle
Ears Yorkshire Terrier
Snout St. Bernard
Mouth Labrador BK
Nose German Shepard
Eyes Beagle
Color Pug

Parents

No Children