Pirate Payton Bitcoin Game Dog - Mix of Shiba Inu, Pug, Labrador BK, Poodle, German Shepard, Corgi, Border Collie and Maltese

Achievements

None
Pirate Payton
My name is Pirate Payton and I do tricks. My favorite song is "Who Let the Dogs Out?" It was me :) I love spending my days curled up in a cozy blanket with a nice, fresh bone to chew. I'm hoping to find someone that doesn't mind the occasional gas after dinner!
  • Purity 8%
  • Age 52 days
  • Racing Exp 0
  • Shiba Inu 27%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GTAGTAGCAGACTCAAGCGTAGAATACGAAACC
G
T
A
G
T
A
G
C
A
G
A
C
T
C
A
A
G
C
G
T
A
G
A
A
T
A
C
G
A
A
A
C
C
Genes: EE6I7OE2J2K

Composition

Shiba Inu
27%
Pug
18%
Labrador BK
9%
Poodle
9%
German Shepard
9%
Corgi
9%
Border Collie
9%
Maltese
9%

Current Energy

Vitality +12 points
Lunar Effect 0 points

Traits Breakdown

Body Shiba Inu
Tail Shiba Inu
Legs Labrador BK
Front Legs Poodle
Head German Shepard
Ears Corgi
Snout Shiba Inu
Mouth Pug
Nose Border Collie
Eyes Pug
Color Maltese

Parents

No Children