Jojo Josie Litecoin Dog - Mix of Husky, German Shepard, Grey Wolf, Labrador, Pug, Corgi and Poodle

Achievements

None
Jojo Josie
I answer to 'Jojo Josie'. Currently, I live on the information superhighway. What's your favorite bed? Mine is the dirty laundry. Let me have a pig's ear and I'm in heaven. I just want the simple things in life. A warm bed, a full food bowl, and a nice butt to sniff.
  • Purity 14%
  • Age 55 days
  • Racing Exp 0
  • Husky 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACATCACCCTCATCACCAGAAAGCGACACAACA
A
C
A
T
C
A
C
C
C
T
C
A
T
C
A
C
C
A
G
A
A
A
G
C
G
A
C
A
C
A
A
C
A
Genes: 47L7752OI44

Composition

Husky
27%
German Shepard
27%
Grey Wolf
9%
Labrador
9%
Pug
9%
Corgi
9%
Poodle
9%

Current Energy

Vitality +40 points
Lunar Effect -20 points

Traits Breakdown

Body Husky
Tail German Shepard
Legs Grey Wolf
Front Legs German Shepard
Head German Shepard
Ears Labrador
Snout Pug
Mouth Corgi
Nose Poodle
Eyes Husky
Color Husky

Parents

No Children