Honeybear Hercules Bitcoin Dog - Mix of Husky, Shiba Inu, Beagle, Labrador BK, Pitbull terrier, Maltese, Rottweiler, Corgi, Border Collie and Labrador

Achievements

None
Honeybear Hercules
How's it going? I'm Honeybear Hercules. They say my bite is worse than my bark. I prefer lounging around the house. Nothing beats the midday sunbeam on the couch! Steak is my absolute favorite, but I prefer to eat chicken for my health. I wish my human wouldn't get mad at me for going through the trash. They were obviously finished with it, why can't I have it?!
  • Purity 1%
  • Age 4 months
  • Racing Exp 0
  • Husky 18%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GTACTAACAGCATCCACCACACACAGCTACCCA
G
T
A
C
T
A
A
C
A
G
C
A
T
C
C
A
C
C
A
C
A
C
A
C
A
G
C
T
A
C
C
C
A
Genes: ED46NK4HOJ5

Composition

Husky
18%
Shiba Inu
9%
Beagle
9%
Labrador BK
9%
Pitbull terrier
9%
Maltese
9%
Rottweiler
9%
Corgi
9%
Border Collie
9%
Labrador
9%

Current Energy

Vitality -21 points
Lunar Effect -8 points

Traits Breakdown

Body Shiba Inu
Tail Beagle
Legs Husky
Front Legs Labrador BK
Head Pitbull terrier
Ears Maltese
Snout Husky
Mouth Rottweiler
Nose Corgi
Eyes Border Collie
Color Labrador

Parents

No Children