Myrtle Mansell Virtual Crypto Game Dog - Mix of Rottweiler, Labrador, German Shepard, Husky, Border Collie, Maltese, Yorkshire Terrier, Corgi and Shiba Inu

Achievements

Racer
Myrtle Mansell
Hullo. My name is Myrtle Mansell. Power outages and computer viruses scare me! Once I caught a seagull, but it scared me so I let it go. Little Bow Wow is my favorite musician. I just assume he's a dog... I enjoy chasing my tail around.
  • Purity 3%
  • Age 55 days
  • Racing Exp 24
  • Rottweiler 18%
  • 3 races
  • Gen 1
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

  • 3 0 0
3 races    Best Time14.60 sec
No rank  Racing *** Coins
100.0 % wins (3) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCACACACACCATACCACACCCCATTAAGCGTA
T
C
A
C
A
C
A
C
A
C
C
A
T
A
C
C
A
C
A
C
C
C
C
A
T
T
A
A
G
C
G
T
A
Genes: 7H45JHK5FOE

Composition

Rottweiler
18%
Labrador
18%
German Shepard
9%
Husky
9%
Border Collie
9%
Maltese
9%
Yorkshire Terrier
9%
Corgi
9%
Shiba Inu
9%

Current Energy

Vitality +39 points
Lunar Effect -6 points

Traits Breakdown

Body German Shepard
Tail Rottweiler
Legs Husky
Front Legs Labrador
Head Border Collie
Ears Rottweiler
Snout Maltese
Mouth Labrador
Nose Yorkshire Terrier
Eyes Corgi
Color Shiba Inu