Fred Floyd Digital Cryptocurrency Game Dog - Mix of Corgi, Yorkshire Terrier, German Shepard, Rottweiler, Labrador, Maltese and Pug

Achievements

None
Fred Floyd
Sup? ;-) I'm Fred Floyd. Baby, I'm made from the same stuff as dreams. I wish I never had to go to the vet's office. They are friendly enough, but it smells funny there. I've been known to run with bad dogs. I'm looking for a hard-working service animal who can keep up with me.
  • Purity 7%
  • Age 55 days
  • Racing Exp 0
  • Corgi 27%
  • 0 races
  • Gen 2
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CACTTAAGCCCAACCAGCTCATTAAGCGAATCA
C
A
C
T
T
A
A
G
C
C
C
A
A
C
C
A
G
C
T
C
A
T
T
A
A
G
C
G
A
A
T
C
A
Genes: HFO5KO7FO27

Composition

Corgi
27%
Yorkshire Terrier
18%
German Shepard
18%
Rottweiler
9%
Labrador
9%
Maltese
9%
Pug
9%

Current Energy

Vitality +2 points
Lunar Effect -10 points

Traits Breakdown

Body Rottweiler
Tail Yorkshire Terrier
Legs Corgi
Front Legs Labrador
Head Maltese
Ears Corgi
Snout German Shepard
Mouth Yorkshire Terrier
Nose Corgi
Eyes Pug
Color German Shepard