Bail Brian Bitcoin Dog - Mix of German Shepard, Shiba Inu, Golder Retriever, Border Collie, Labrador BK, Maltese, Pug and Poodle

Achievements

None
Bail Brian
Once you go digital, baby, you never go back. Let me have a pig's ear and I'm in heaven. Long, leisurely walks to catch up on my pee-mail is my favorite thing on Sundays. If you have fleas or ticks, don't bother. Sometimes I forget where I buried my bone. Looking for that special tail wag.
  • Purity 6%
  • Age 55 days
  • Racing Exp 0
  • German Shepard 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCAAGATCATACTCAGCAACCGAAGTAGACGTA
T
C
A
A
G
A
T
C
A
T
A
C
T
C
A
G
C
A
A
C
C
G
A
A
G
T
A
G
A
C
G
T
A
Genes: 787J76K2EIE

Composition

German Shepard
27%
Shiba Inu
18%
Golder Retriever
9%
Border Collie
9%
Labrador BK
9%
Maltese
9%
Pug
9%
Poodle
9%

Current Energy

Vitality +34 points
Lunar Effect -12 points

Traits Breakdown

Body German Shepard
Tail Golder Retriever
Legs German Shepard
Front Legs Border Collie
Head German Shepard
Ears Labrador BK
Snout Maltese
Mouth Pug
Nose Shiba Inu
Eyes Poodle
Color Shiba Inu