Longboi Lacie Crypto Dog - Mix of Poodle, Schnauzer, Labrador BK, Border Collie, Grey Wolf, Corgi and Beagle

Achievements

None
Longboi Lacie
I'm Longboi Lacie. How goes it? I keep my well-built figure with zeros and ones. If I had to pick a favorite food it would be a hot-dog, because you are what you eat! I'd like to find a dawg to hang with, no pressure. We can always make puppies later.
  • Purity 6%
  • Age 52 days
  • Racing Exp 0
  • Poodle 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GACATACCCGCATACAGCTACGACATACTAGCA
G
A
C
A
T
A
C
C
C
G
C
A
T
A
C
A
G
C
T
A
C
G
A
C
A
T
A
C
T
A
G
C
A
Genes: ICL6JOJICD6

Composition

Poodle
18%
Schnauzer
18%
Labrador BK
18%
Border Collie
18%
Grey Wolf
9%
Corgi
9%
Beagle
9%

Current Energy

Vitality +33 points
Lunar Effect -4 points

Traits Breakdown

Body Poodle
Tail Schnauzer
Legs Grey Wolf
Front Legs Labrador BK
Head Border Collie
Ears Corgi
Snout Border Collie
Mouth Poodle
Nose Schnauzer
Eyes Beagle
Color Labrador BK